Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 63750465 63761220 enh52045

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 63752684 rs145464513 ACAGCCTAGAATGCAGGGGAAT A 4019917
chr15 63752684 rs376001899 ACAGCCTAGAATGCAGGGGAAT A 4019918

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results