Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 65527365 65549035 enh31459

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 65543940 rs11270085 GGATCCCCAGCAAAACTTATGGTTCATTTT G 4030540
chr15 65543940 rs55987031 GGATCCCCAGCAAAACTTATGGTTCATTTT G 4030541

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results