EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr15:65543933-65543949]
Chromosome characteristics of ZNF143[chr15:65543933-65543949]
Back to top
Enhancers possibly regulated by ZNF143[chr15:65543933-65543949]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 65527365 65549035 enh31459
Bone Marrow (K562) Liver (HepG2) Large Intestine Ovary Esophagus Astrocyte Lung Stomach Muscle (Myoblast) Spleen Uterus Heart
SNP sites on ZNF143[chr15:65543933-65543949]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 65543940 rs11270085 GGATCCCCAGCAAAACTTATGGTTCATTTT G 4030540
chr15 65543940 rs55987031 GGATCCCCAGCAAAACTTATGGTTCATTTT G 4030541
Genes possibly regulated by ZNF143[chr15:65543933-65543949]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr15:65543933-65543949]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results