Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68299625 68326035 enh16263

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68304688 rs558342232 T TTGTTGTTTGAAACAACACCTGCCATGTCTCACC 4048720

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results