EnhancerDB
  1. Home
  2. TFBS
  3. ESR1[chr15:68872708-68872712]
Chromosome characteristics of ESR1[chr15:68872708-68872712]
Back to top
Enhancers possibly regulated by ESR1[chr15:68872708-68872712]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68870248 68907505 enh52065
Prostate (PC-3) Liver (HepG2) Kidney Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Lung (PC-9) Bone (Osteoblast) Blood (OCI-LY7) Stomach Muscle (A673) Thyroid Breast Embryonic Stem Cell Line (H1-hESC) Muscle (Myoblast) Pancreas Uterus Heart
SNP sites on ESR1[chr15:68872708-68872712]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68872711 rs142062120 TCAGATGGAGGGTCAGAGCAGTGGGGC T 4052863
chr15 68872711 rs67351715 TCAGATGGAGGGTCAGAGCAGTGGGGC T 4052864
chr15 68872711 rs781480924 TCAGATGGAGGGTCAGAGCAGTGGGGC T 4052865
Genes possibly regulated by ESR1[chr15:68872708-68872712]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ESR1[chr15:68872708-68872712]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results