Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68909310 68918753 enh3686

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68917930 rs377538576 C CTTGTTTGTTGTTTCTTGTTTTGGGT 4053394
chr15 68917930 rs555400936 C CTTGTTTGTTGTTTCTTGTTTTGGGT 4053395

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results