Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 71485665 71498915 enh52076

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 71497003 rs368585921 GGTCCAGTCCAGAGCTTCCCACGA G 4073254
chr15 71497003 rs565434506 GGTCCAGTCCAGAGCTTCCCACGA G 4073255

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results