Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 55596805 55635295 enh7228

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 55627971 rs577645939 GTCAGATGCCAGCATTGACCCT G 6747628

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results