Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 100848265 100854235 enh62535

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 100850928 rs369931409 GGCTTTACTGGGCTTTTCCCCTAA G 4231911
chr15 100850928 rs560463363 GGCTTTACTGGGCTTTTCCCCTAA G 4231912

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results