EnhancerDB
  1. Home
  2. TFBS
  3. FEV[chr7:2139225-2139235]
Chromosome characteristics of FEV[chr7:2139225-2139235]
Back to top
Enhancers possibly regulated by FEV[chr7:2139225-2139235]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 2129984 2180255 enh9566
Bone Marrow (K562) Astrocyte Colon (HCT116) Blood (Karpas-422) Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Thymus Prostate (PC-3) Large Intestine Esophagus Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr7 2139021 2139385 vista54837
VISTA
SNP sites on FEV[chr7:2139225-2139235]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 2139234 rs140660754 TGAGCGCATCGGGCTGGGAGACAGCC T 9579690
chr7 2139234 rs55752133 TGAGCGCATCGGGCTGGGAGACAGCC T 9579691
Genes possibly regulated by FEV[chr7:2139225-2139235]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FEV[chr7:2139225-2139235]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results