EnhancerDB
  1. Home
  2. TFBS
  3. NR3C2[chr1:957952-957969]
Chromosome characteristics of NR3C2[chr1:957952-957969]
Back to top
Enhancers possibly regulated by NR3C2[chr1:957952-957969]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 953925 964515 enh26489
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Astrocyte Stomach Muscle (A673) Pancreas Uterus Epithelial (MCF-7)
SNP sites on NR3C2[chr1:957952-957969]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 957967 rs141489152 T TTGTAGTCTGACCTGTGGTCTGAC 2137
chr1 957967 rs6143083 T TTGTAGTCTGACCTGTGGTCTGAC 2138
Genes possibly regulated by NR3C2[chr1:957952-957969]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR3C2[chr1:957952-957969]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results