Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr1 | 1004737 | rs538252203 | GGTGGGGGCGTGGCCCTGCGGGGCGTGGCCT | G | 2598 | |
chr1 | 1004741 | rs529180079 | G | C | 2599 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr1 | 1006346 | 1009687 | - | RNF223 | ENSG00000237330.2 | 1009687 | 0.97 | 1.0 | 4945 | 14 |
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|