Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3480715 rs74048623 G A 23280
chr1 3480724 rs181674010 G A 23281
chr1 3480728 rs532956943 AGGGTGGGGGAGCTGAGTCG A 23282

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results