EnhancerDB
  1. Home
  2. TFBS
  3. RORA[chr1:3480718-3480728]
Chromosome characteristics of RORA[chr1:3480718-3480728]
Back to top
Enhancers possibly regulated by RORA[chr1:3480718-3480728]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3448190 3482098 enh11432
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-MC) Prostate (RWPE1) Brain (SK-N-SH) Esophagus Astrocyte Stomach Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Muscle (Myotube) Uterus Thymus Heart
SNP sites on RORA[chr1:3480718-3480728]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3480724 rs181674010 G A 23281
chr1 3480728 rs532956943 AGGGTGGGGGAGCTGAGTCG A 23282
Genes possibly regulated by RORA[chr1:3480718-3480728]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RORA[chr1:3480718-3480728]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results