Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 57158525 57167635 enh35423

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 57162579 rs576424859 C CGAAATCCATTCACTAAAGATAAAGATATGTTAG 6756588

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results