Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 6411925 6440995 enh26

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 6438317 rs201202672 GTGTCTATGATCAGCATGCCCTC G 38817
chr1 6438317 rs374532521 GTGTCTATGATCAGCATGCCCTC G 38818

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results