Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 6924365 6931380 enh32

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 6928409 rs555998297 CAAAAAACGACTGTATAGGGTT C 41868

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results