Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 8281665 8294711 enh11466

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 8284706 rs375122773 GGCACAGTGGCTCACCCCTGTAATCCCA G 53407
chr1 8284706 rs58902380 GGCACAGTGGCTCACCCCTGTAATCCCA G 53408
chr1 8284707 rs74224589 G A 53409

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results