EnhancerDB
  1. Home
  2. TFBS
  3. TAL1[chr1:9467203-9467215]
Chromosome characteristics of TAL1[chr1:9467203-9467215]
Back to top
Enhancers possibly regulated by TAL1[chr1:9467203-9467215]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 9456143 9468501 enh26526
Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Stomach Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Thymus Heart
SNP sites on TAL1[chr1:9467203-9467215]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 9467209 rs553637490 AGATGCTTCTTGAATGCTGTTTGAAC A 65040
Genes possibly regulated by TAL1[chr1:9467203-9467215]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TAL1[chr1:9467203-9467215]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results