Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr1 | 9892669 | 9907022 | enh42876 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr1 | 9899720 | rs550461196 | ACGCCCAGCTAATTTGTGTATTTTTTGTAGAGACAAGGTCT | A | 68952 | |
chr1 | 9899722 | rs58485145 | G | A | 68953 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|