Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 14575716 14592006 enh73

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 14584626 rs577936195 C G 94480
chr1 14584634 rs376221205 CGTCCCAAAACTGTCCCAAAACT C 94481
chr1 14584634 rs571775848 CGTCCCAAAACT C 94482
chr1 14584634 rs71570193 CGTCCCAAAACT C 94483

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results