EnhancerDB
  1. Home
  2. TFBS
  3. HES7[chr1:15266122-15266134]
Chromosome characteristics of HES7[chr1:15266122-15266134]
Back to top
Enhancers possibly regulated by HES7[chr1:15266122-15266134]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 15262048 15272235 enh11524
Liver (HepG2) Brain (SK-N-SH) Prostate (RWPE1) Large Intestine Esophagus Bone (Osteoblast) Placenta Thyroid Muscle (Myoblast) Pancreas Uterus Stomach
SNP sites on HES7[chr1:15266122-15266134]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 15266122 rs370940082 TTGGGACGTGCCTCTTGCATAGGGTGGAGTG T 100352
chr1 15266122 rs573144608 T A 100353
chr1 15266129 rs542158731 G A,C 100354
Genes possibly regulated by HES7[chr1:15266122-15266134]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HES7[chr1:15266122-15266134]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results