Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 16618809 16629372 enh58080

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 16622884 rs375696089 T TGCCTGTAATCCCAACACTTTGGGA 111401
chr1 16622884 rs549245273 T TGCCTGTAATCCCAACACTTTGGGA 111402

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results