EnhancerDB
  1. Home
  2. TFBS
  3. HNF4A[chr1:22466625-22466640]
Chromosome characteristics of HNF4A[chr1:22466625-22466640]
Back to top
Enhancers possibly regulated by HNF4A[chr1:22466625-22466640]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 22456485 22467815 enh47148
Esophagus Muscle (A673) Uterus Thymus Stomach
SNP sites on HNF4A[chr1:22466625-22466640]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 22466626 rs569370226 CTAGACCTTGCTCCTTGGCAGGT C 149423
Genes possibly regulated by HNF4A[chr1:22466625-22466640]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 22443798 22470462 - WNT4 ENSG00000162552.10 22470462 0.93 1.0 3822 298
Expression level of Genes
Back to top
miRNAs possibly regulated by HNF4A[chr1:22466625-22466640]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results