Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 22456485 22467815 enh47148

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 22466626 rs569370226 CTAGACCTTGCTCCTTGGCAGGT C 149423

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 22443798 22470462 - WNT4 ENSG00000162552.10 22470462 0.93 1.0 3821 298


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results