EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr1:25362447-25362467]
Chromosome characteristics of RREB1[chr1:25362447-25362467]
Back to top
Enhancers possibly regulated by RREB1[chr1:25362447-25362467]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 25355194 25369035 enh149
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Blood (GM12878) Peripheral Blood (MM.1S) Blood (Karpas-422) Pancreas Thymus Stomach
SNP sites on RREB1[chr1:25362447-25362467]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 25362465 rs142100707 CACCACCATTATCATCAGCACTACCATA C 170688
chr1 25362465 rs369448038 CACCACCATTATCATCAGCACTACCATA C 170689
chr1 25362467 rs201051747 C T 170690
Genes possibly regulated by RREB1[chr1:25362447-25362467]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr1:25362447-25362467]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results