| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 25355194 | 25369035 | enh149 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 25362465 | rs142100707 | CACCACCATTATCATCAGCACTACCATA | C | 170688 | |
| chr1 | 25362465 | rs369448038 | CACCACCATTATCATCAGCACTACCATA | C | 170689 | |
| chr1 | 25362467 | rs201051747 | C | T | 170690 | |
| chr1 | 25362474 | rs536120390 | T | C | 170691 | |
| chr1 | 25362476 | rs554436726 | T | C | 170692 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|