EnhancerDB
  1. Home
  2. TFBS
  3. JUN[chr1:40286868-40286881]
Chromosome characteristics of JUN[chr1:40286868-40286881]
Back to top
Enhancers possibly regulated by JUN[chr1:40286868-40286881]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 40278465 40303035 enh11766
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Blood (T-cell) Bone (Osteoblast) Blood (OCI-LY7) Stomach Placenta Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Thymus Epithelial (MCF-7)
SNP sites on JUN[chr1:40286868-40286881]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 40286872 rs531546133 GTGAGGTCAGGAGTTCAAGGACCTCACC G 250905
chr1 40286872 rs59168349 GTGAGGTCAGGAGTTCAAGGACCTCACC G 250906
chr1 40286877 rs76736263 G A 250907
Genes possibly regulated by JUN[chr1:40286868-40286881]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by JUN[chr1:40286868-40286881]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results