Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 40465285 40473406 enh11771

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 40471582 rs529835186 C CTAGAAAATCAGTGGATATACTGAATG 252707

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results