Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 44182725 44190779 enh42940

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 44188964 rs371922816 GAGACGGGATTTCACCATGTTGGCC G 274477

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results