EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr1:44235878-44235899]
Chromosome characteristics of ZNF263[chr1:44235878-44235899]
Back to top
Enhancers possibly regulated by ZNF263[chr1:44235878-44235899]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 44221165 44237481 enh300
Skin (Keratinocyte) Liver (HepG2) Brain (SK-N-MC) Prostate (RWPE1) Lung (PC-9) Esophagus Blood (GM12878) Muscle (A673) Thyroid Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on ZNF263[chr1:44235878-44235899]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 44235882 rs544506145 TGAGGAGAGGAGAGGGGAGGG T 274916
chr1 44235882 rs558747199 TGAGGAGAGGAGAGGGGAGGG T 274917
chr1 44235882 rs757625386 TGAGGAGAGGAGAGGGGAGGG T 274918
Genes possibly regulated by ZNF263[chr1:44235878-44235899]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr1:44235878-44235899]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results