Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 54581508 54594355 enh26714

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 54588727 rs375859288 CCACCCAGCCTTTGGCCTGG C 318000
chr1 54588727 rs67430669 CCACCCAGCCTTTGGCCTGG C 318001

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results