Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 92290636 92304575 enh12040

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 92294343 rs143171371 TCACTGCAGTTCCAGGACCCTCC T 481506
chr1 92294343 rs369993566 TCACTGCAGTTCCAGGACCCTCC T 481507

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results