Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 95311245 95322815 enh12083

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 95314590 rs528457199 GAACTGCCAGCCTGTGCCCCTT G 499059

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results