Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 95476045 95491597 enh26980
chr1 95484238 95484316 vista2584

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 95484225 rs564609955 G GAGAGCAGGAAATTCACCCCCTAT 500538

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results