Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 112488845 112503775 enh47227

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 112503493 rs535200628 A AGGCCTGGGGCCATGGCAGTT 561752

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results