Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 116704752 116717555 enh576

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 116710919 rs574481446 G C 585887
chr1 116710920 rs201045424 GGCGCTGGGGCACCTGGAGAGGGC G 585888

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results