EnhancerDB
  1. Home
  2. TFBS
  3. PAX5[chr1:154824714-154824733]
Chromosome characteristics of PAX5[chr1:154824714-154824733]
Back to top
Enhancers possibly regulated by PAX5[chr1:154824714-154824733]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 154772139 154826495 enh644
Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Esophagus Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Placenta Thyroid Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Pancreas Embryonic Stem Cell Line (H1-hESC) Muscle (Myotube) Uterus Thymus Stomach
SNP sites on PAX5[chr1:154824714-154824733]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 154824714 rs59461045 G T 641421
chr1 154824722 rs149811701 TCTGCTGCCCAGGCTGGAGTGCAGAGGCA T 641422
chr1 154824722 rs368240904 TCTGCTGCCCAGGCTGGAGTGCAGAGGCA T 641423
Genes possibly regulated by PAX5[chr1:154824714-154824733]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PAX5[chr1:154824714-154824733]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results