Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156960065 156980795 enh12304

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156964628 rs150156827 AGGTAATACTACCTTTCTCAAAG A 651914
chr1 156964628 rs745828850 AGGTAATACTACCTTTCTCAAAG A 651915
chr1 156964629 rs6667037 G A 651916

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results