Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167115728 167134954 enh12348

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167129217 rs540353729 TCCAAGAGCATGGCACTGGCATCTGC T 699868

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results