Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 182267181 182275215 enh12439
chr1 182269466 182269764 vista4139

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 182269630 rs550008885 A AACCCCAAGAGGGTCTTACAGGAACCC 773889

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results