Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 185360409 185365255 enh58187

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 185362501 rs531746399 TTGACGTAGCTTAAATTACTCACTTAGTGA T 792390
chr1 185362505 rs562935374 C T 792391

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results