EnhancerDB
  1. Home
  2. TFBS
  3. NR3C1[chr1:202349237-202349255]
Chromosome characteristics of NR3C1[chr1:202349237-202349255]
Back to top
Enhancers possibly regulated by NR3C1[chr1:202349237-202349255]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 202346449 202351955 enh67240
Prostate (PC-3) Stomach Peripheral Blood (MM.1S) Lung (PC-9) Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on NR3C1[chr1:202349237-202349255]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 202349254 rs138287663 TCTTTGCTTAACTGCTCCTGCTCCC T 861807
chr1 202349254 rs372521689 TCTTTGCTTAACTGCTCCTGCTCCC T 861808
Genes possibly regulated by NR3C1[chr1:202349237-202349255]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR3C1[chr1:202349237-202349255]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results