Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 202346449 202351955 enh67240

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 202349254 rs138287663 TCTTTGCTTAACTGCTCCTGCTCCC T 861807
chr1 202349254 rs372521689 TCTTTGCTTAACTGCTCCTGCTCCC T 861808

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results