Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 207561205 207573294 enh27443

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207571498 rs557800674 GTGTGTGTGTGTGTGTGTGTA G 894599
chr1 207571516 rs115151207 G A 894600

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results