EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr1:225811369-225811379]
Chromosome characteristics of SP1[chr1:225811369-225811379]
Back to top
Enhancers possibly regulated by SP1[chr1:225811369-225811379]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 225811205 225817543 enh64193
Heart Brain (SK-N-SH) Breast Neural Stem Cells (H9) Stomach
SNP sites on SP1[chr1:225811369-225811379]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 225811369 rs549430197 G C 986319
chr1 225811373 rs370951812 CGCCTCCTGGGTTCACACCATTCTCCTGCCTCA C 986320
chr1 225811373 rs58308330 CGCCTCCTGGGTTCACACCATTCTCCTGCCTCA C 986321
chr1 225811377 rs531934539 T C 986322
Genes possibly regulated by SP1[chr1:225811369-225811379]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr1:225811369-225811379]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results