EnhancerDB
  1. Home
  2. TFBS
  3. PAX5[chr1:228076599-228076618]
Chromosome characteristics of PAX5[chr1:228076599-228076618]
Back to top
Enhancers possibly regulated by PAX5[chr1:228076599-228076618]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 228069592 228093895 enh12737
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Blood (T-cell) Lung Stomach Placenta Breast Embryonic Stem Cell Line (H1-hESC) Pancreas Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
SNP sites on PAX5[chr1:228076599-228076618]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 228076603 rs375569713 GCCAGGCATGCATGGCTCAGGTGTCCACGGC G 999653
chr1 228076603 rs575862390 GCCAGGCATGCATGGCTCAGGTGTCCACGGC G 999654
chr1 228076609 rs546193892 C T 999655
chr1 228076615 rs191891984 T A 999656
Genes possibly regulated by PAX5[chr1:228076599-228076618]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PAX5[chr1:228076599-228076618]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results