Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 228925865 228943255 enh12750

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 228940490 rs200184345 CAGGTGAGCTGGACCTGCTGTGG C 1004523
chr1 228940490 rs71813635 CAGGTGAGCTGGACCTGCTGTGG C 1004524

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results