EnhancerDB
  1. Home
  2. TFBS
  3. RFX2[chr1:234700161-234700177]
Chromosome characteristics of RFX2[chr1:234700161-234700177]
Back to top
Enhancers possibly regulated by RFX2[chr1:234700161-234700177]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 234695125 234703195 enh12791
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Ovary Placenta Thyroid Lung (PC-9) Pancreas Pancreas (Panc1) Uterus Epithelial (MCF-7)
SNP sites on RFX2[chr1:234700161-234700177]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 234700166 rs376025005 G GTCATAGAATCCTAGTGTGTAAC 1043414
chr1 234700166 rs569557655 G GTCATAGAATCCTAGTGTGTAAC 1043415
Genes possibly regulated by RFX2[chr1:234700161-234700177]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX2[chr1:234700161-234700177]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results