EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB18[chr11:465443-465456]
Chromosome characteristics of ZBTB18[chr11:465443-465456]
Back to top
Enhancers possibly regulated by ZBTB18[chr11:465443-465456]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 463965 472535 enh13672
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Lung (PC-9) Pancreas Pancreas (Panc1) Muscle (Myotube) Uterus Heart
SNP sites on ZBTB18[chr11:465443-465456]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 465453 rs548105949 GTGAGCTATCA G 1786750
chr11 465453 rs564612557 GTGAGCTATCATGCCCAGGCATAATTATAAAACATC G 1786751
chr11 465453 rs927517397 GTGAGCTATCA G 1786752
Genes possibly regulated by ZBTB18[chr11:465443-465456]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB18[chr11:465443-465456]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results